|  Help  |  About  |  Contact Us

Allele : Ccdc191<em1(IMPC)J> coiled-coil domain containing 191; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5911509 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Ccdc191
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TCCCAGTTGTACATTCCGAT, GAGAGTGGTCAGAGCTGTGA, GGTTTAATGCTGAGAAACGA and GCACTCGGAATGTGTTTGCA, which resulted in a 982 bp deletion beginning at Chromosome 16 positive strand position 43,943,264 bp and ending after 43,944,245 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000713202 (exon 9) and 521 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence and early truncation after residue 443.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories