|  Help  |  About  |  Contact Us

Allele : Idh3b<em1(IMPC)J> isocitrate dehydrogenase 3 (NAD+) beta; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5904256 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Idh3b
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Idh3b-8297J-2446F was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCACGCAGACACAACTAACA, AAATTCCTAAATGTCAGTAG, TTGCCTTCTTTTGGAAACCG and AGGTCAGATCGGGGACACCG, which resulted in a 772 bp deletion beginning at Chromosome 2 negative strand position 130,284,280 bp, GTGTCCCCGATCTGACCTTG, and ending after GGGTCAGACCCTGTTAGTTG at 130,283,509 bp (GRCm38/mm10). This mutation deletes exons 2,3,4 and 474 bp of intervening and flanking intronic sequence including the splice acceptors and donors and is predicted to cause a change of amino acid sequence after residue 12 and early truncation 12 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

5 Publication categories