|  Help  |  About  |  Contact Us

Allele : Polr1d<em1(IMPC)J> polymerase (RNA) I polypeptide D; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5904258 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Polr1d
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Polr1d-8546J-1608M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ATTTGACTCCAGCAAAGAGG, GCCCTGCTGCAAGATGAAAA, AGATAATTGGGCCAAGGTAG and TAGTGTTGGTTCAATTAAGA, which resulted in a 938 bp deletion beginning at Chromosome 5 positive strand position 147,078,255 bp, CATCTTGCAGCAGGGCCTAC, and ending after AACAGATAATTGGGCCAAGG at 147,079,192 bp (GRCm38/mm10). This mutation deletes exon 2 and 386 bp of flanking intronic sequence including the splice acceptor and polyA site and is predicted to generate the first 8 amino acids followed by nonsense mediated decay.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Polr1d<->,
  • Polr1d<->
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

6 Publication categories