| Primary Identifier | MGI:5904258 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Polr1d |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Polr1d-8546J-1608M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ATTTGACTCCAGCAAAGAGG, GCCCTGCTGCAAGATGAAAA, AGATAATTGGGCCAAGGTAG and TAGTGTTGGTTCAATTAAGA, which resulted in a 938 bp deletion beginning at Chromosome 5 positive strand position 147,078,255 bp, CATCTTGCAGCAGGGCCTAC, and ending after AACAGATAATTGGGCCAAGG at 147,079,192 bp (GRCm38/mm10). This mutation deletes exon 2 and 386 bp of flanking intronic sequence including the splice acceptor and polyA site and is predicted to generate the first 8 amino acids followed by nonsense mediated decay. |
