|  Help  |  About  |  Contact Us

Allele : Gramd1b<em1(IMPC)J> GRAM domain containing 1B; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5910393 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Gramd1b
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCAACCTTCTACTACCATGA, GGGAGTTCCAGAGAACACTC, CTTGGCCTCCCAGAGACTAT and GCAATGGACCCACATACTAT, which resulted in a 474 bp deletion beginning at Chromosome 9 negative strand position 40,317,723 bp and ending after 40,317,250 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001256460 (exon 5) and 389 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 10 bp insertion (GGTAGTAGAA) at the deletion site that will not alter the result of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 229 and early truncation 35 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories