|  Help  |  About  |  Contact Us

Allele : Lins1<em1(IMPC)J> lines homolog 1; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5910408 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Lins1
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences GCAACACAGGATAGAAGTGA, ATACACCACACGCCACTCCA and CCTGAGGTGGTAATCCTTTG, which resulted in a disrupted deletion of 466 bp in total beginning at Chromosome 7 positive strand position 66,709,117 bp and deleting 197 bases then 3 endogenous bp (GGT) are retained, followed by an additional deletion of 269 bp ending at 66,709,585 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001273824 (exon 5) and 327 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 181 and early truncation 1 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele