| Primary Identifier | MGI:7790792 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Rr56163 |
| Strain of Origin | C57BL/6 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | The Cyp24a1 promoter was targeted using sgRNAs (equivalent to GGGGACCGACTGGCAAGGATGGG and CGCTTGCACAATCGCCACTCAGG) and an ssODN template with CRISPR/Cas9 technology, resulting in the mutation of vitamin-D-response-element 2 (VDRE2) from GGTTCAGCGGGTGCG to aaTTtAGCtaaccCG. |