| Primary Identifier | MGI:5904336 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Syt14 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Syt14-8616J-6466M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCTCTCCTTGGCAACCACGG, TAAGGTACGAGAAGCTACAA, CTTATTGGATGAGAGGAGAG and TTATGAATTCTACACAGCAT, which resulted in a 544 bp deletion beginning at Chromosome 1 negative strand position 192,933,556 bp, GAGAGTGGAAAGCTAAGGAA, and ending after CAGTGTCTCATCCCTTGTAG at 192,933,013 bp (GRCm38/mm10). This mutation deletes exon 5 and 272 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 148 and early truncation 11 amino acids later. |
