|  Help  |  About  |  Contact Us

Allele : Sdhaf2<em1(IMPC)J> succinate dehydrogenase complex assembly factor 2; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5904343 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Sdhaf2
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Sdhaf2-8595J-8861M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCAAGATGCAGCTCAGCATA, GATATGACTTTAGACTCTAA, ATAAAGGGACCAAAATCCGC and ACAGTAACCATTGTCTAACG, which resulted in a 570 bp deletion beginning at Chromosome 19 negative strand position 10517492 bp CGCAGGACTAAGTGAGATCT, and ending after ATAACAAGCCCATTAGAGTC at 10516923 bp (GRCm38/mm10). This mutation deletes exons 2 and 3 and 242 bp of intervening and flanking intronic sequence including the splice acceptors and donors and is predicted to cause a change of amino acid sequence after residue 12 and early truncation 16 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Sdhaf2<->,
  • Sdhaf2<->
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

6 Publication categories