| Primary Identifier | MGI:5904343 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Sdhaf2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Sdhaf2-8595J-8861M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCAAGATGCAGCTCAGCATA, GATATGACTTTAGACTCTAA, ATAAAGGGACCAAAATCCGC and ACAGTAACCATTGTCTAACG, which resulted in a 570 bp deletion beginning at Chromosome 19 negative strand position 10517492 bp CGCAGGACTAAGTGAGATCT, and ending after ATAACAAGCCCATTAGAGTC at 10516923 bp (GRCm38/mm10). This mutation deletes exons 2 and 3 and 242 bp of intervening and flanking intronic sequence including the splice acceptors and donors and is predicted to cause a change of amino acid sequence after residue 12 and early truncation 16 amino acids later. |
