| Primary Identifier | MGI:5910309 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Dhtkd1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences TAGTGGCGAGCGATCTTTGC, GTTTGTAATGGAGCTCACGG and CCGCCCAGAAGGGAAGTCGA, which resulted in a 597 bp deletion beginning at Chromosome 2 negative strand position 5,931,083 bp ACGGTGGAAGCAGCAGAGGC, and ending after TTCCTGCAAAGATCGCTCGC at 5,930,487 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000605446 (exon 3) and 385 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 105 and early truncation 1 amino acid later. |
