| Primary Identifier | MGI:5910317 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Washc4 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CATGCAGCTCCTAAATGGCA, CAAGACTGCTTTGTCAGTGT, ATAAAAGCAGCCTAACCCTA and TTAGGATGTTCAGACACTGC, which resulted in a 258 bp deletion beginning at Chromosome 10 positive strand position 83,554,686 bp GACACTGACAAAGCAGTCTT, and ending after AGGATGTTCAGACACTGCTG at 83,554,943 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000293860 (exon 7) and 175 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 145 and early truncation 17 amino acids later. |
