| Primary Identifier | MGI:5910550 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Lrrc55 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences CGGATACAGCGCTGTACAGC and GCTGGCAGCAGCAGTGCTGT, which resulted in a 702 bp deletion beginning at Chromosome 2 negative strand position 85,196,683 bp and ending after 85,195,982 bp (GRCm38/mm10). This mutation deletes 702 bp from ENSMUSE00000643986 (exon 1) including the ATG start site but retains the last 3 bp (CGG) in the exon and thus the splice donor. While a null is expected, an unidentified alternate start site could potentially permit translation of exon 2. |
