|  Help  |  About  |  Contact Us

Allele : Lrrc55<em1(IMPC)J> leucine rich repeat containing 55; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5910550 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Lrrc55
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences CGGATACAGCGCTGTACAGC and GCTGGCAGCAGCAGTGCTGT, which resulted in a 702 bp deletion beginning at Chromosome 2 negative strand position 85,196,683 bp and ending after 85,195,982 bp (GRCm38/mm10). This mutation deletes 702 bp from ENSMUSE00000643986 (exon 1) including the ATG start site but retains the last 3 bp (CGG) in the exon and thus the splice donor. While a null is expected, an unidentified alternate start site could potentially permit translation of exon 2.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

3 Publication categories

Trail: Allele