| Primary Identifier | MGI:5910587 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ndufa9 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGCTCTTTAGAACTTGACCA, GGACTCACGGGTGCTCCACA, GTATTGACAATGAGTAGGCC and GCCTTAGGAAAAATTACTTT, which resulted in a 416 bp deletion beginning at Chromosome 6 positive strand position 126,840,391 bp and ending after 126,840,806 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000240808 (exon 5) and 274 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 137 and early truncation 6 amino acids later. |
