| Primary Identifier | MGI:5911628 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Cpsf7 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCACTGATTGAAATATTGCT, GTCTTAATCCCCAAACATAG, GAGACCATCTGTATGAAGGG and GGTTTGGTGGCACAATTAGT, which resulted in a 970 bp deletion beginning at Chromosome 19 positive strand position 10,532,605 bp and ending after 10,533,574 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000224989 and ENSMUSE00000224978 (exons 4 and 5) and 693 bp of flanking intronic sequence including the splice acceptors and donors and is predicted to cause a change of amino acid sequence after residue 91 and early truncation 50 amino acids later. |
