| Primary Identifier | MGI:5910604 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Cdk2ap2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGTCACGTAGAGCTTGTAGG, CCCGGATTGCAAAACTCGAG, CATAAGGAGGTGCCACCAGG and AAAGGGCCCTTCCTGTAGAT, which resulted in a 1715 bp deletion beginning at Chromosome 19 positive strand position 4,097,571 bp and ending after 4,099,285 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001249854, ENSMUSE00001264241, ENSMUSE00000145584 (exons 2-4) and 961 bp of flanking intronic sequence including the splice acceptors and donors and may cause a change of amino acid sequence after residue 27 and early truncation 30 amino acids later by translation of unspliced mRNA. |
