|  Help  |  About  |  Contact Us

Allele : Cdk2ap2<em1(IMPC)J> cyclin dependent kinase 2 associated protein 2; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5910604 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Cdk2ap2
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGTCACGTAGAGCTTGTAGG, CCCGGATTGCAAAACTCGAG, CATAAGGAGGTGCCACCAGG and AAAGGGCCCTTCCTGTAGAT, which resulted in a 1715 bp deletion beginning at Chromosome 19 positive strand position 4,097,571 bp and ending after 4,099,285 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001249854, ENSMUSE00001264241, ENSMUSE00000145584 (exons 2-4) and 961 bp of flanking intronic sequence including the splice acceptors and donors and may cause a change of amino acid sequence after residue 27 and early truncation 30 amino acids later by translation of unspliced mRNA.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele