|  Help  |  About  |  Contact Us

Allele : Tmem171<em1(IMPC)J> transmembrane protein 171; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5904780 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Tmem171
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Tmem171-8631J-5335M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CATCAAAGCTCACAGAGCAG, GCTGAGTGTGAGCAGCGAGG, GAAACACCCTTGAGTGCGCG and ACTTGACATGGAACTGTCGC, which resulted in a 359 bp deletion beginning at Chromosome 13 negative strand position 98,688,580 bp, ACTCAAGGGTGTTTCGGCCT, and ending after TGTTTGAGATCCCGCCTCGC at 98,688,222 bp (GRCm38/mm10). This mutation deletes exon 3 and 223 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 6 bp (CTGTCG) intronic deletion 25 bp before the 359 bp deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 213 and early truncation 86 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

3 Publication categories