| Primary Identifier | MGI:5904784 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Tldc2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Tldc2-8630J-5356M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TCTGTGGCAGAGGGCATAAG, CAGTGTTGTGTAGGGACTGG, GGCCCATGGCCCTTTCCCAA and GTGTGACGTGACTGGGAACG, which resulted in a 470 bp deletion beginning at Chromosome 2 positive strand position 157,095,100 bp, GATCTGTGGCAGAGGGCATA, and ending after GTGACGTGACTGGGAACGAG at 157,095,569 bp (GRCm38/mm10). This mutation deletes exon 5 and 396 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 143 and early truncation 24 amino acids later. |