| Primary Identifier | MGI:5905648 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Rab8a |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Rab8a-8582J-1846M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGGCGACAACAGTAGCTGAA, CTAAAGCCTTCTACAGGCTG, CCAGTGTAGAGTCCAGCGAA and CACGATTCAGGGCCCAAACA, which resulted in a 233 bp deletion beginning at Chromosome 8 positive strand position 72,168,281 bp, CTTCAGCTACTGTTGTCGCC, and ending after GCTAGTGCCTTGTTTGGGCC at 72,168,513 bp (GRCm38/mm10). This mutation deletes exon 2 and 172 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a single bp insertion (G) 18 bp after the exon deletion, that will not affect the results of the exon deletion. This allele is predicted to cause a change of amino acid sequence after residue 42 and early truncation 54 amino acids later. |
