| Primary Identifier | MGI:5905666 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Rxylt1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Tmem5-8633J-5241F was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGGTCTATATAACTGCTAGA, GTATTTTTCCCAAGCTGAAG, TATGGCAGTTAACTGTACGA and AGAATACTGTATTTACACCG, which resulted in a 382 bp deletion beginning at Chromosome 10 negative strand position 122,094,873 bp, CGTACAGTTAACTGCCATAT, and ending after GTCATTTCCCCTTCAGCTTG at 122,094,492 bp (GRCm38/mm10). This mutation deletes exon 3 and 279 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 14 bp deletion (TTCCTCGGTGTAAA) 64 bp before the 382 bp deletion that will not alter the result of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 109 and early truncation 7 amino acids later. |
