|  Help  |  About  |  Contact Us

Allele : Styxl1<em1(IMPC)J> serine/threonine/tyrosine interacting-like 1; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5905733 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Styxl1
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Styxl1-8615J-6464M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ACAGGGAGTAAGTATCCACC, CGCAGAGAGCAGATGCACGG, ACTCAGAACTGGACACGTGA and ACATGAGAACACTGGTGGGC, which resulted in a 333 bp deletion beginning at Chromosome 5 negative strand position 135,768,952 bp, CGTGTCCAGTTCTGAGTTCA, and ending after AAGGTCCATACAGCCCCCG at 135,768,620 bp (GRCm38/mm10). This mutation deletes exon 3 and 271 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 34 and early truncation 55 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories