| Primary Identifier | MGI:5905734 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Tpk1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Tpk1-8645J-9675M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCAGCGAGTCAGGGTCTACA, TAGGAAACCACCTCTGTGAG, TCTCCAGTCCATCTGAACAG and CCAGCTTCGGTAATAAAAGA, which resulted in a 415 bp deletion beginning at Chromosome 6 negative strand position 43,560,232 bp, CTGTTCAGATGGACTGGAGA, and ending after ACCACCTCTGTGAGAGGGCT at 43,559,818 bp (GRCm38/mm10). This mutation deletes exon 4 and 345 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 4 bp deletion (AAAG) 49 bp before the 415 bp deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 39 and early truncation 49 amino acids later. |