|  Help  |  About  |  Contact Us

Allele : Tpk1<em1(IMPC)J> thiamine pyrophosphokinase; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5905734 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Tpk1
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Tpk1-8645J-9675M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCAGCGAGTCAGGGTCTACA, TAGGAAACCACCTCTGTGAG, TCTCCAGTCCATCTGAACAG and CCAGCTTCGGTAATAAAAGA, which resulted in a 415 bp deletion beginning at Chromosome 6 negative strand position 43,560,232 bp, CTGTTCAGATGGACTGGAGA, and ending after ACCACCTCTGTGAGAGGGCT at 43,559,818 bp (GRCm38/mm10). This mutation deletes exon 4 and 345 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 4 bp deletion (AAAG) 49 bp before the 415 bp deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 39 and early truncation 49 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Tpk1<->,
  • Tpk1<->
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

5 Publication categories