| Primary Identifier | MGI:5905737 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Taf13 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Taf13-8618J-6493M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTATACTTTCCATACCAACT, CATTGGTCAGTCTCTGAGTC, GCACAAAGCAGGCACTCTAA and TGATGTGATATTCAGAGTAA, which resulted in a 310 bp deletion beginning at Chromosome 3 positive strand position 108,578,035 bp, GTTTAATCCTAGTTGGTATG, and ending after CTATCCATTAGAGTGCCTGC at 108,578,344 bp (GRCm38/mm10). This mutation deletes exon 3 and 212 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 35 and early truncation 15 amino acids later. Although mutant mRNA is produced, a mutant protein likely retains no TAF13 functions based on early missense amino acids and early termination. |