| Primary Identifier | MGI:5905739 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Zfp940 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Zfp940-8675J-5908M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ACTATTCTCTCTCATAACCG, TGCTGCTGCACGAACATTCA, AGGATACACCAAAATATCGG and AGAGCTGGTAGTCTGGAGTA, which resulted in a 478 bp deletion beginning at Chromosome 7 negative strand position 29,847,106 bp, TCCATGTCGCTTCCTGCCCT, and ending after CTCTCATAACCGAGGAACCA at 29,846,629 bp (GRCm38/mm10). This mutation deletes exon 3 and 351 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 3 and early truncation 40 amino acids later. |
