|  Help  |  About  |  Contact Us

Allele : Zfp940<em1(IMPC)J> zinc finger protein 940; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5905739 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Zfp940
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Zfp940-8675J-5908M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ACTATTCTCTCTCATAACCG, TGCTGCTGCACGAACATTCA, AGGATACACCAAAATATCGG and AGAGCTGGTAGTCTGGAGTA, which resulted in a 478 bp deletion beginning at Chromosome 7 negative strand position 29,847,106 bp, TCCATGTCGCTTCCTGCCCT, and ending after CTCTCATAACCGAGGAACCA at 29,846,629 bp (GRCm38/mm10). This mutation deletes exon 3 and 351 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 3 and early truncation 40 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

3 Publication categories