| Primary Identifier | MGI:5905771 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Zscan5b |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Zscan5b-8665J-4435M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ATTCGTTTATGTGGGATAAT, TATGAATGTTCCCACAACTC, GCCAACACCAGAGTTGAGTT and TACCCTTGTCTGACACTCTT, which resulted in a 370 bp deletion beginning at Chromosome 7 positive strand position 6,233,707 bp, CTCTGGAAAAAAGTGAGTGT, and ending after CCAGAGTTGAGTTTGGACAA at 6,234,076 bp (GRCm38/mm10). This mutation deletes exon 5 and 216 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 187 and early truncation 5 amino acids later. |
