|  Help  |  About  |  Contact Us

Allele : Slc9a9<em1(IMPC)J> solute carrier family 9 (sodium/hydrogen exchanger), member 9; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5905784 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Slc9a9
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Slc9a9-8597J-8865F was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CAGTCAACTATGGGAGACGT, TGTGTCGTTGGAATAAGTCA, AGGCGTATACCTATGTAAAG and ATACAACGCAAATACAGCCC, which resulted in a 563 bp deletion beginning at Chromosome 9 positive strand position 94,684,901 bp, GTAAGTATCTGTGAGTAAAC, and ending after TTTTCCAGCAAGCCAGGGCT at 94,685,463 bp (GRCm38/mm10). This mutation deletes exon 2 and 360 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 19 bp deletion (AGTCAGTAATGTCCGTGAC) 25 bp before the 563 bp deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 58 and early truncation 3 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories