| Primary Identifier | MGI:5905784 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Slc9a9 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Slc9a9-8597J-8865F was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CAGTCAACTATGGGAGACGT, TGTGTCGTTGGAATAAGTCA, AGGCGTATACCTATGTAAAG and ATACAACGCAAATACAGCCC, which resulted in a 563 bp deletion beginning at Chromosome 9 positive strand position 94,684,901 bp, GTAAGTATCTGTGAGTAAAC, and ending after TTTTCCAGCAAGCCAGGGCT at 94,685,463 bp (GRCm38/mm10). This mutation deletes exon 2 and 360 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 19 bp deletion (AGTCAGTAATGTCCGTGAC) 25 bp before the 563 bp deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 58 and early truncation 3 amino acids later. |