| Primary Identifier | MGI:5907256 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Arhgap11a |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Arhgap11a-8693J-5061M was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences ATGGAGAGAATATCTCAAAC, GAATGCGCTAGAGTATCTGA and ATTAGGCAAATAAAGATCTT, which resulted in a 322 bp deletion beginning at Chromosome 2 positive strand position 113,845,222 bp TGAGATATTCTCTCCATTTT, and ending after AGATTAAAACACTGCCTTCA at 113,845,543 bp (GRCm38/mm10). This mutation deletes exon 2 (ENSMUSE00001066810) and 251 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 43 and early truncation 3 amino acids later. |
