|  Help  |  About  |  Contact Us

Allele : Arhgap11a<em1(IMPC)J> Rho GTPase activating protein 11A; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5907256 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Arhgap11a
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Arhgap11a-8693J-5061M was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences ATGGAGAGAATATCTCAAAC, GAATGCGCTAGAGTATCTGA and ATTAGGCAAATAAAGATCTT, which resulted in a 322 bp deletion beginning at Chromosome 2 positive strand position 113,845,222 bp TGAGATATTCTCTCCATTTT, and ending after AGATTAAAACACTGCCTTCA at 113,845,543 bp (GRCm38/mm10). This mutation deletes exon 2 (ENSMUSE00001066810) and 251 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 43 and early truncation 3 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele