|  Help  |  About  |  Contact Us

Allele : Thap1<em1(IMPC)J> THAP domain containing, apoptosis associated protein 1; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5909270 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Thap1
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences TCTGGTTACCAATCTCCCTC, TTTAGTAAGCCGGAGAGTGTand TGTGTTCATGGGAAAAATCA, which resulted in a 597 bp deletion beginning at Chromosome 8 positive strand position 26,160,640 bp, GGGAGATTGGTAACCAGAACT, and ending after TGTTCATGGGAAAAATCAGG at 26,161,236 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000250934 (exon 2) and 401 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is predicted to cause a change of amino acid sequence after residue 24 and early truncation 26 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories