| Primary Identifier | MGI:5909270 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Thap1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences TCTGGTTACCAATCTCCCTC, TTTAGTAAGCCGGAGAGTGTand TGTGTTCATGGGAAAAATCA, which resulted in a 597 bp deletion beginning at Chromosome 8 positive strand position 26,160,640 bp, GGGAGATTGGTAACCAGAACT, and ending after TGTTCATGGGAAAAATCAGG at 26,161,236 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000250934 (exon 2) and 401 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is predicted to cause a change of amino acid sequence after residue 24 and early truncation 26 amino acids later. |
