| Primary Identifier | MGI:5909238 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Retnlg |
| Inheritance Mode | Not Specified | Strain of Origin | Not Specified |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Retnlg-8758J-9754M was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences GAGATCACTGAGCTATGGGA, TGAAAGTATTTACTGCATTG and AAGAGCTTAGACCAGGGTAC, which resulted in a 243 bp deletion beginning at Chromosome 16 positive strand position 48,872,815 bp ATAGCTCAGTGATCTCATCT, and ending after GAGCTTTTGCTGATGCTGAC at 48,873,057 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000980093 (exon 2) and 91 bp of flanking intronic sequence including the splice acceptor, ATG start site and splice donor. In addition there is a single bp insertion, A, 216 bp before the deletion that is not expected to alter the results of the exon deletion. This mutation is predicted to cause an early truncation after 6 amino acids. |
