|  Help  |  About  |  Contact Us

Allele : Eid2<em1(IMPC)J> EP300 interacting inhibitor of differentiation 2; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5909135 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Eid2
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGCGGGGCGCTGCTGACTGC, CTGCGGGGCGCTGCTGACTG, AATCCTCTAATAGAAGAACT and CAATCCTCTAATAGAAGAAC, which resulted in a 658 bp deletion beginning at Chromosome 7 positive strand position 28267973 bp GTCAGCAGCGCCCCGCAGAC, and ending after GATCAATCCTCTAATAGAAG at 28268630 bp (GRCm38/mm10). This mutation creates an internal deletion of 658 bp from ENSMUSE00000339928 (exon 1) and is predicted to cause a change of amino acid sequence after residue 6 and early truncation 74 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories