| Primary Identifier | MGI:5909135 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Eid2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGCGGGGCGCTGCTGACTGC, CTGCGGGGCGCTGCTGACTG, AATCCTCTAATAGAAGAACT and CAATCCTCTAATAGAAGAAC, which resulted in a 658 bp deletion beginning at Chromosome 7 positive strand position 28267973 bp GTCAGCAGCGCCCCGCAGAC, and ending after GATCAATCCTCTAATAGAAG at 28268630 bp (GRCm38/mm10). This mutation creates an internal deletion of 658 bp from ENSMUSE00000339928 (exon 1) and is predicted to cause a change of amino acid sequence after residue 6 and early truncation 74 amino acids later. |
