| Primary Identifier | MGI:5909204 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Cdh7 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences GGATTTCACATTGTATATTC, GACCACGCCTGCACATAGAA and GAAAGAAGCTAGTATGCCAT, which resulted in a total deletion of 650 bp beginning at Chromosome 1 positive strand position 110,048,663 bp GTATATTCTGGCTTCTTAGC, and ending after TTTAATAAATGGCTTGTGTA at 110,049,333 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001292496 (exon 3) and 355 bp of flanking intronic sequence including the splice acceptor and donor. Additionally, 55 bp after the end of this exon there is 21 bp of retained endogenous sequence (GTGCAGGCGTGGTCAGAAAGG) followed by an additional 144 bp deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 70 and early truncation 6 amino acids later. |