|  Help  |  About  |  Contact Us

Allele : Cdh7<em1(IMPC)J> cadherin 7, type 2; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5909204 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Cdh7
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences GGATTTCACATTGTATATTC, GACCACGCCTGCACATAGAA and GAAAGAAGCTAGTATGCCAT, which resulted in a total deletion of 650 bp beginning at Chromosome 1 positive strand position 110,048,663 bp GTATATTCTGGCTTCTTAGC, and ending after TTTAATAAATGGCTTGTGTA at 110,049,333 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001292496 (exon 3) and 355 bp of flanking intronic sequence including the splice acceptor and donor. Additionally, 55 bp after the end of this exon there is 21 bp of retained endogenous sequence (GTGCAGGCGTGGTCAGAAAGG) followed by an additional 144 bp deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 70 and early truncation 6 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele