| Primary Identifier | MGI:5909220 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Fnbp1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Fnbp1-8741J-1502M was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences GGTGTCCTCCTCCAAAGACA, TCTGGCCTGAGAATAAACAG and TTACAACCCAAACCCGGCCA, which resulted in a 397 bp deletion beginning at Chromosome 2 negative strand position 31,096,377 bp, CTGAGAATAAACAGAGGCAG, and ending after CAAAGACAAGGATGTTCTAC at 31,095,981 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001281997 (exon 4) and 249 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 67 and early truncation 10 amino acids later. |
