|  Help  |  About  |  Contact Us

Allele : Fnbp1<em1(IMPC)J> formin binding protein 1; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5909220 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Fnbp1
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Fnbp1-8741J-1502M was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences GGTGTCCTCCTCCAAAGACA, TCTGGCCTGAGAATAAACAG and TTACAACCCAAACCCGGCCA, which resulted in a 397 bp deletion beginning at Chromosome 2 negative strand position 31,096,377 bp, CTGAGAATAAACAGAGGCAG, and ending after CAAAGACAAGGATGTTCTAC at 31,095,981 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001281997 (exon 4) and 249 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 67 and early truncation 10 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele