|  Help  |  About  |  Contact Us

Allele : Taco1<em1(IMPC)J> translational activator of mitochondrially encoded cytochrome c oxidase I; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5911953 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Taco1
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CACAGTATAGGAGAAACAAG, TTCTCCTATACTGTGGTGAG, GACTCCTTAAATTGTCAGGG and GCCCCCAGAGAGTATATGTT, which resulted in a 239 bp deletion beginning at Chromosome 11 positive strand position 106,069,452 bp and ending after 106,069,690 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000108225 (exon 2) and 132 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 91 and early truncation 8 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories