| Primary Identifier | MGI:5912100 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Gabrr3 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ACTGTATTCCAATTTCAGAG, CTGAAGTTATGACCCGAGCA, TTAAAGAGTGGGCAACAAGT and AGTGTACAGCAAGTACTTGG, which resulted in a 564 bp deletion beginning at Chromosome 16 positive strand position 59,429,807 bp and ending after 59,430,370 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000698978 (exon 4) and 340 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 100 and early truncation 29 amino acids later. |