| Primary Identifier | MGI:5907845 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Rab10 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences ATAAACTGTTTAGATTGTTG, ATAAGCTCCACACTTCATAG, GCTGAGCTCAAACTTTAGGA, which resulted in a 452 bp deletion beginning at Chromosome 12 positive strand position 3,256,825 bp, ATTGTTGAGGGAGAGAGGGC, and ending after ATAAGCTCCACACTTCATAG at 3,257,276 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000462111 (exon 3) and 313 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 62 and early truncation 11 amino acids later. |
