| Primary Identifier | MGI:5907638 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Asf1b |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences AGAGGCCTAATTTTCCCGGG, CGAGAGGAACCATATAGTAG, AGTGTGCTTTCAGGTAAAAG, which resulted in a 526 bp deletion spanning ENSMUSE00001257874 (exon 2) beginning at Chromosome 8 positive strand position 83,964,745 bp CTACTATATGGTTCCTCTCG, and ending after CTAGAACCTTCCTCTTTTAC at 83,965,270 bp (GRCm38/mm10). This mutation deletes exon 2 and 410 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 36 and early truncation 1 amino acid later. |
