| Primary Identifier | MGI:5907829 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Akr1c19 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences TCATAGAACTGGATTATCAC, CAGAATTAAACTCCAAGGTG, AGGAGGCTTCTGAACTCATA, which resulted in a 520 bp deletion beginning at Chromosome 13 positive strand position 4,242,346 bp GTGTGGCTCATAGAACTGGA, and ending after TTGAGTGGGTACCCTATGAG at 4,242,865 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000980302 (exon 6) and 410 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 190 and early truncation 11 amino acids later. |