|  Help  |  About  |  Contact Us

Allele : Akr1c19<em1(IMPC)J> aldo-keto reductase family 1, member C19; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5907829 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Akr1c19
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences TCATAGAACTGGATTATCAC, CAGAATTAAACTCCAAGGTG, AGGAGGCTTCTGAACTCATA, which resulted in a 520 bp deletion beginning at Chromosome 13 positive strand position 4,242,346 bp GTGTGGCTCATAGAACTGGA, and ending after TTGAGTGGGTACCCTATGAG at 4,242,865 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000980302 (exon 6) and 410 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 190 and early truncation 11 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

5 Publication categories