| Primary Identifier | MGI:5906318 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Zfp202 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Zfp202-8671J-6805M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GATTAAAGGTTGAAAGAAGG, AAATTCCTGCTTGTCATCAG, GGGGTTCTCTTGTACCACAA and TCGAGAAGCTGATCTAAAGT, which resulted in a 652 bp deletion beginning at Chromosome 9 positive strand position 40,208,107 bp, AAGGGGGAAATTAGAAGAGT, and ending after GACAATTCTGCCCACTTTAG at 40,208,758 bp (GRCm38/mm10). This mutation deletes exon 3 and 441 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 134 and early truncation 7 amino acids later. |
