| Primary Identifier | MGI:7569317 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Dnaaf5 |
| Strain of Origin | C57BL/6 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | A 21 bp deletion was created in exon 4 (CAGACAGCCACCAGCCTATGG) using an sgRNA (targeting GCAGACAGCCACCAGCCTATGGG) and an ssODN template with CRISPR/Cas9 technology. The in-frame deletion, at the 5' end of the exon, may affect the splice acceptor site and deletes codons for critical residues in the encoded peptide. |
