|  Help  |  About  |  Contact Us

Allele : Dnaaf5<em3Slb> dynein, axonemal assembly factor 5; endonuclease-mediated mutation 3, Steven L Brody

Primary Identifier  MGI:7569317 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Dnaaf5
Strain of Origin  C57BL/6 Is Recombinase  false
Is Wild Type  false
molecularNote  A 21 bp deletion was created in exon 4 (CAGACAGCCACCAGCCTATGG) using an sgRNA (targeting GCAGACAGCCACCAGCCTATGGG) and an ssODN template with CRISPR/Cas9 technology. The in-frame deletion, at the 5' end of the exon, may affect the splice acceptor site and deletes codons for critical residues in the encoded peptide.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

3 Publication categories

Trail: Allele