| Primary Identifier | MGI:7569249 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Dnaaf5 |
| Strain of Origin | C57BL/6 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Cysteine codon 498 (TGT) in exon 7 was targeted for change to phenylalanine (TTT) (c.1493G>T, p.C498F) using an sgRNA (targeting CACACAGCAGCAGATGCTCCAGG) and an ssODN template with CRISPR/Cas9 technology. This allele contains an unintended 7 bp deletion in exon 7 (c.1476_1482delGGAGCAT), leading to a frameshift and premature stop codon (p.E493fs*28). |
