|  Help  |  About  |  Contact Us

Allele : Dnaaf5<em1Slb> dynein, axonemal assembly factor 5; endonuclease-mediated mutation 1, Steven L Brody

Primary Identifier  MGI:7569243 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Dnaaf5
Strain of Origin  C57BL/6 Is Recombinase  false
Is Wild Type  false
molecularNote  Cysteine codon 498 (TGT) in exon 7 was changed to phenylalanine (TTT) (c.1493G>T, p.C498F) using an sgRNA (targeting CACACAGCAGCAGATGCTCCAGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human c.1499G>T (p.C500F) mutation associated with primary ciliary dyskinesia (PCD).
  • mutations:
  • Single point mutation
  • synonyms:
  • Dnaaf5<C498F>,
  • Dnaaf5<C498F>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

3 Publication categories