| Primary Identifier | MGI:7569243 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Dnaaf5 |
| Strain of Origin | C57BL/6 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Cysteine codon 498 (TGT) in exon 7 was changed to phenylalanine (TTT) (c.1493G>T, p.C498F) using an sgRNA (targeting CACACAGCAGCAGATGCTCCAGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human c.1499G>T (p.C500F) mutation associated with primary ciliary dyskinesia (PCD). |
