| Primary Identifier | MGI:6117095 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Als2cl |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTAGACCCAGATGCAGAACG, TACCCCATAGAGCTCCTCAG, CTGAGCAGCCAGAATCCTGA and AAGCCAATACCCTAGACCAT, which resulted in a 518 bp deletion beginning at Chromosome 9 positive strand position 110,884,771 bp and ending after 110,885,288 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000332740 (exon 4) and 319 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 35 and early truncation 31 amino acids later. |